Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
circRNA-CER | |||
Gene | RNF121 | Organism | Human |
Genome Locus | chr11:71668272-71671937:+ | Build | hg19 |
Disease | Osteoarthritis (OA) | ICD-10 | Polyarthrosis, unspecified (M15.9) |
DBLink | Link to database | PMID | 26931159 |
Experimental Method | |||
Sample Type | Tissues | Comparison | 20 patients undergoing total knee arthroplasty (7 men and 13 women; age range 57-73 years) and normal articular cartilage was isolated from the knee joints of 10 donors after death or from trauma patients (5 men and 5 women; age range 29-65 years) |
Method for Estimation | Quantitative PCR and Microarrays | PCR Details | |
Primers (Experimented) | Forward CTGGTGCAGTGGAAGCAGAG ReverseCGACCCTCCATTGCTCTTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Liu, Q, Zhang, X, Hu, X, Dai, L, Fu, X, Zhang, J, Ao, Y (2016). Circular RNA Related to the Chondrocyte ECM Regulates MMP13 Expression by Functioning as a MiR-136 'Sponge' in Human Cartilage Degradation. Sci Rep, 6:22572. |