circad | circRNAs associated with diseases
circRNA-CER
 GeneRNF121OrganismHuman
 Genome Locuschr11:71668272-71671937:+Buildhg19
 DiseaseOsteoarthritis (OA)ICD-10 Polyarthrosis, unspecified (M15.9)
 DBLinkLink to databasePMID26931159
 Experimental Method
 Sample TypeTissuesComparison20 patients undergoing total knee arthroplasty (7 men and 13 women; age range 57-73 years) and normal articular cartilage was isolated from the knee joints of 10 donors after death or from trauma patients (5 men and 5 women; age range 29-65 years)
 Method for EstimationQuantitative PCR and MicroarraysPCR Details
 Primers
(Experimented)
Forward

CTGGTGCAGTGGAAGCAGAG

Reverse

CGACCCTCCATTGCTCTTCT

StatisticsFold Change : Upregulated
pvalue : p<0.05
 Citation
Liu, Q, Zhang, X, Hu, X, Dai, L, Fu, X, Zhang, J, Ao, Y (2016). Circular RNA Related to the Chondrocyte ECM Regulates MMP13 Expression by Functioning as a MiR-136 'Sponge' in Human Cartilage Degradation. Sci Rep, 6:22572.